LOCUS       MT456994                 794 bp    DNA     linear   PLN 24-FEB-2021
DEFINITION  Colletotrichum lupini strain PJ64 calmodulin (CAL) gene, partial
            cds.
ACCESSION   MT456994
VERSION     MT456994.1
KEYWORDS    .
SOURCE      Colletotrichum lupini
  ORGANISM  Colletotrichum lupini
            Eukaryota; Fungi; Dikarya; Ascomycota; Pezizomycotina;
            Sordariomycetes; Hypocreomycetidae; Glomerellales; Glomerellaceae;
            Colletotrichum; Colletotrichum acutatum species complex.
REFERENCE   1  (bases 1 to 794)
  AUTHORS   Martin,P.L., Krawczyk,T., Khodadadi,F., Acimovic,S.G. and Peter,K.
  TITLE     Bitter Rot of Apple in the Mid-Atlantic US: Causal Species and
            Evaluation of the Impacts of Regional Weather Patterns and Cultivar
            Susceptibility
  JOURNAL   Phytopathology (2021) In press
   PUBMED   33487025
  REMARK    Publication Status: Available-Online prior to print
REFERENCE   2  (bases 1 to 794)
  AUTHORS   Martin,P.L. and Peter,K.A.
  TITLE     Direct Submission
  JOURNAL   Submitted (11-MAY-2020) Plant Pathology and Environmental
            Microbiology, The Pennsylvania State University, 290 University
            Drive, Biglerville, PA 17307, USA
COMMENT     ##Assembly-Data-START##
            Sequencing Technology :: Sanger dideoxy sequencing
            ##Assembly-Data-END##
FEATURES             Location/Qualifiers
     source          1..794
                     /organism="Colletotrichum lupini"
                     /mol_type="genomic DNA"
                     /strain="PJ64"
                     /isolation_source="Florida"
                     /host="Lupinus albus (lupine)"
                     /db_xref="taxon:145971"
                     /collection_date="1993"
                     /PCR_primers="fwd_name: cl1c, fwd_seq:
                     gaattcaaggaggccttctc, rev_name: cl2c, rev_seq:
                     cttctgcatcatgagctggac"
     gene            <1..>794
                     /gene="CAL"
     mRNA            join(<1..11,94..109,262..387,456..526,577..718,781..>794)
                     /gene="CAL"
                     /product="calmodulin"
     CDS             join(<1..11,94..109,262..387,456..526,577..718,781..>794)
                     /gene="CAL"
                     /codon_start=3
                     /product="calmodulin"
                     /protein_id="QNO10912.1"
                     /translation="SLFDKDGDGQITTKELGTVMRSLGQNPSESELQDMINEVDADNN
                     GTIDFPEFLTMMARKMKDTDSEEEIREAFKVFDRDNNGFISAAELRHVMTSIGEKLTD
                     DEVDEMIREADQDGDGRIDYNEFV"
ORIGIN      
        1 tctccctctt tgtaagtcac tccgagttcg tcccggacga agttcctttt cctcaaaagg
       61 tattttcgga tgtgagctga cccattcata caggacaagg acggcgatgg tcagtacctg
      121 gtccccccct ttccctttct ctcgaccccg cgccagtaca atttcgactc ccgcgaccgc
      181 ttcgatacca gatcagcatt gggacattgt cgagatttga tcatgtggat ttcagggcac
      241 ggagctaaag aatacggaca ggacaaatta caaccaagga gctcggcacc gtcatgcgct
      301 ccctgggaca gaacccctcc gagtctgagc ttcaggacat gatcaacgag gttgacgccg
      361 acaacaacgg aacgatcgac ttccctggta ggtctacaca ataaccactg gcaatcacgc
      421 acacgaaagc gactcgctga cgaataatct ggcagagttc ctcaccatga tggcccgcaa
      481 gatgaaggac accgactccg aggaggagat tcgtgaagcc ttcaaggtga gacgagctag
      541 tgcaacccgc acgtagacaa cgctgaccag agaaaggtct ttgaccgcga taacaacggc
      601 ttcatatccg ccgccgagct tcgccacgtc atgacttcaa tcggcgagaa gctcaccgac
      661 gatgaggttg atgagatgat tcgcgaggct gaccaggacg gcgatggacg cattgactgt
      721 aagaacgcga catccgtgtt cacgctgctc attgctcacg ttgctaacac acgttcccag
      781 acaacgagtt cgtc
//